Virus:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Recombinant:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Article Title: A pluripotent stem cell atlas of multilineage differentiation.
Article Snippet: .. For the remaining samples, cells were treated with a small molecule or recombinant protein signalling perturbation as detailed in Table 1, added BC Line Condition Library 1 Library 2 Library 3 Concentration Treatment Source BC01 Control Day 5 Day 2 Day 9 — — — BC02 Low XAV Day 5 Day 2 Day 9 1uM XAV939 STEMCELL Technologies #72674 BC03 XAV Day 5 — Day 9 5uM XAV939 STEMCELL Technologies #72674 BC04 CHIR Day 5 Day 2 Day 9 3uM CHIR99021 STEMCELL Technologies #72054 BC05 Low Dorso Day 5 Day 2 Day 9 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC06 Dorso Day 5 Day 2 Day 9 4uM Dorsomorphin Sigma-Aldrich #P5499 BC07 K02288 Day 5 Day 2 Day 9 0.5uM K02288 Cayman Chemical #16678 BC08 BMP4 Day 5 Day 2 Day 9 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC11 VEGF Day 5 Day 2 Day 9 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 BC10 Control Day 2 Day 9 Day 5 — — — BC09 Low XAV Day 2 Day 9 Day 5 1uM XAV939 STEMCELL Technologies #72674 BC12 XAV Day 2 Day 9 Day 5 5uM XAV939 STEMCELL Technologies #72674 BC13 CHIR Day 2 Day 9 Day 5 3uM CHIR99021 STEMCELL Technologies #72054 BC14 Low Dorso Day 2 Day 9 Day 5 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC15 Dorso Day 2 Day 9 Day 5 4uM Dorsomorphin Sigma-Aldrich #P5499 BC16 K02288 Day 2 Day 9 Day 5 0.5uM K02288 Cayman Chemical #16678 BC17 BMP4 Day 2 Day 9 Day 5 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC18 VEGF Day 2 Day 9 Day 5 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 Table 1. ..
Article Title: Adrenergic-Independent Signaling via CHRNA2 Regulates Beige Fat Activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-UCP1 Abcam Cat# ab10983; RRID: AB_2241462 Rabbit polyclonal anti-a-tubulin Cell Signaling Cat# 2144; RRID: AB_2210548 Total OXPHOS rodent antibody cocktail Abcam Cat# ab110413; RRID: AB_2629281 Rabbit monoclonal anti-phospho-CREB Cell Signaling Cat# 9198; RRID: AB_2561044 Rabbit monoclonal anti-CREB Cell Signaling Cat# 9197; RRID: AB_331277 Rabbit polyclonal anti-HSP90 Cell Signaling Cat# 4874; RRID: AB_2121214 Rabbit polyclonal anti-phospho-PKA substrate Cell Signaling Cat# 9621; RRID: AB_330304 Rabbit monoclonal anti-COX IV Cell Signaling Cat# 4850; RRID: AB_2085424 Rabbit monoclonal anti-VDAC Cell Signaling Cat# 4661; RRID: AB_10557420 Rabbit monoclonal anti-b-actin Cell Signaling Cat# 8457; RRID: AB_10950489 Chemicals 3-Isobutyl-1-methylxanthine Sigma Aldrich Cat# I7018 Acetylcholine chloride Sigma Aldrich Cat# A2661 Biotin Sigma Aldrich Cat# B4639 CL 316.243 hydrate Sigma Aldrich Cat# C5976 Dexamethasone Sigma Aldrich Cat# D4902 Dibutyryl-cAMP Sigma Aldrich Cat# D0260 D-pantothenic acid hemicalcium salt Sigma Aldrich Cat# P5155 Fura 2-AM Sigma Aldrich Cat# F0888 Insulin for cells Sigma Aldrich Cat# I5500 Insulin – Humulin R for ITT Eli Lily Cat# HI-210 Isoproterenol Sigma Aldrich Cat# I6504 Nicotine Sigma Aldrich Cat# N3876 Oligomycin A Sigma Aldrich Cat# 75351 Propranolol hydrochloride Sigma Aldrich Cat# PHR1308 Tri Reagent Sigma Aldrich Cat# 93289 Rosiglitazone Cayman chemical Cat# 71740 Recombinant human BMP4 R&D Systems Cat# 3141-BP-010 Collagenase D Roche Cat# 11088882001 Dispase II Roche Cat# 04942078001 SYBR Green Applied Biosystems Cat# 4368708 M-MLV Reverse Transcriptase Invitrogen Cat# 28025021 Critical Commercial Assays Cytochrome c Release Assay Kit Abcam Cat# ab65311 Citrate Synthase Activity Assay Kit Cayman chemical Cat# 701040 L-Lactate Assay Kit Cayman chemical Cat# 1200011002 Experimental Models: Cell Lines C2C12 cells ATCC Cat# CRL-1772 Mouse primary inguinal preadipocytes N/A N/A Human primary adipose stromal cells Dr. Jeffrey M. Gimble N/A Experimental Models: Organisms/Strains Mouse: Adiponectin-Cre The Jackson Laboratory Cat# 010803 Mouse: Myod1-CreERT2 The Jackson Laboratory Cat# 025667 (Continued on next page) Developmental Cell 54, 106–116.e1–e5, July 6, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ucp1 knockout The Jackson Laboratory Cat# 003124 Mouse: C57BL/6J The Jackson Laboratory Cat# 00664 Mouse: Ucp1-Cre The Jackson Laboratory Cat# 024679 Mouse: Chrna2 knockout The Jackson Laboratory Cat# 005797 Mouse: b-less Dr. Brad Lowell N/A Mouse: b1WT Dr. Jun Wu N/A Mouse: b3WT Dr. Jun Wu N/A Mouse: Chrna2fl/fl Dr. Jun Wu N/A Oligonucleotides qPCR primers, see Table S1 Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Fwd AGCACCAATCTGCGTTAATCTATG Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Rev ACTGTGAGATAGGGACAGAAAAGA Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Fwd CTGCCTTTTCATGCTGCACTCC Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Rev CCTCAGGGTCACCCAATCACAGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Fwd TCGCTACCAGAGTTTGCTGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Rev GGCACGTAGAAGGAGACGAC Integrated DNA Technologies N/A Genotyping: Adrb1 KO/Adrb2 KO 2/Adrb3 KO Fwd TCGCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb1 KO Rev GCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb2 WT/Adrb2 KO 1 Fwd GAGCGACTACAAACCGTCAC Integrated DNA Technologies N/A Genotyping: Adrb2 WT Rev CAGCAAGTCTCCTCGGTGTA Integrated DNA Technologies N/A Genotyping: Adrb3 WT Rev GCATGTTGGAGGCAAAGGAA Integrated DNA Technologies N/A Genotyping: Adrb3 KO Rev GCTTAGCCACAACGAACACTC Integrated DNA Technologies N/A Recombinant DNA MSCV-GFP Dr. Jun Wu N/A MSCV-CRE Dr. Jun Wu N/A Lentiviral vector for Gabpa GeneCopoeia Cat# EX-Mm02614-Lv120 Lentiviral shRNA clones 1 and 2 for Gabpa GeneCopoeia Cat# MSH027139-LVRU6GH Lentiviral shRNA clones for scrambled control GeneCopoeia Cat# CSHCTR001-LVRU6GH Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Excel Microsoft https://www.microsoft.com/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ MetaFluor software Molecular Devices https://www.moleculardevices.com/
Article Title: Ligand-based directed differentiation to produce granulosa-like cells expressing steroidogenic enzyme genes.
Article Snippet: .. Key resources table Reagent or Resource Source Identifier Antibodies FOXL2 Abcam Cat# ab246511; RRID:AB_2895602 Donkey anti Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 568, Invitrogen Fisher Scientific Cat# A10042; RRID:AB_2534017 Hoechst Sigma-Aldrich Cat# B226125MG Chemicals, peptides, and recombinant proteins Advanced RPMI 1640 Medium Thermo Fisher Scientific Cat# 12633020 ROCK Inhibitor Y27632 ATCC Cat# ACS-3030 CHIR99021 EMD Millipore Cat# 361559- 5MG Gallocyanine Abcam Cat# ab145230 Recombinant human BMP4 R&D Systems Cat# 314-BP-050/ CF Recombinant human FST R&D Systems Cat# 669-FO025/CF Retinoic acid Sigma-Aldrich Cat# R262550MG Recombinant human SHH STEMCELL Technologies Cat# 78065 PD0325901 Sigma-Aldrich Cat# PZ01625MG Recombinant human EGF Sigma-Aldrich Cat# E96440.5MG Recombinant human FGF2 R&D Systems Cat# 233-FB-025/ CF Dulbecco’s Phosphate Buffered Saline Millipore Sigma Cat# D8537 Bovine Serum Albumin Ambion Cat# AM2616 Commercial assays Quick RNA MiniPrep Kit Zymo Research Cat# R1055 Oligonucleotides RT2 qPCR Primer Assay for Human NR5A1 Qiagen Cat# PPH05887B RT2 qPCR Primer Assay for Human CYP19A1 Qiagen Cat# PPH00132E RT2 qPCR Primer Assay for Human HSD17B1 Qiagen Cat# PPH21736B For custom primers for qPCR, See Table S1 Cell lines IISH2i-BM9 iPSC line WiCell IISH2i-BM9 STiPS-A3 iPSC line HSCI iPS core facility STiPS-A3 AN1.1 iPSC line GESC@ MGI at Washington University School of Medicine AN1.1 ..
Clinical Proteomics:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Purification:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Synthesized:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Phospho-proteomics:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Transduction:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
DNA Library Preparation:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
RNA Sequencing:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Control:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Article Title: A pluripotent stem cell atlas of multilineage differentiation.
Article Snippet: .. For the remaining samples, cells were treated with a small molecule or recombinant protein signalling perturbation as detailed in Table 1, added BC Line Condition Library 1 Library 2 Library 3 Concentration Treatment Source BC01 Control Day 5 Day 2 Day 9 — — — BC02 Low XAV Day 5 Day 2 Day 9 1uM XAV939 STEMCELL Technologies #72674 BC03 XAV Day 5 — Day 9 5uM XAV939 STEMCELL Technologies #72674 BC04 CHIR Day 5 Day 2 Day 9 3uM CHIR99021 STEMCELL Technologies #72054 BC05 Low Dorso Day 5 Day 2 Day 9 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC06 Dorso Day 5 Day 2 Day 9 4uM Dorsomorphin Sigma-Aldrich #P5499 BC07 K02288 Day 5 Day 2 Day 9 0.5uM K02288 Cayman Chemical #16678 BC08 BMP4 Day 5 Day 2 Day 9 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC11 VEGF Day 5 Day 2 Day 9 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 BC10 Control Day 2 Day 9 Day 5 — — — BC09 Low XAV Day 2 Day 9 Day 5 1uM XAV939 STEMCELL Technologies #72674 BC12 XAV Day 2 Day 9 Day 5 5uM XAV939 STEMCELL Technologies #72674 BC13 CHIR Day 2 Day 9 Day 5 3uM CHIR99021 STEMCELL Technologies #72054 BC14 Low Dorso Day 2 Day 9 Day 5 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC15 Dorso Day 2 Day 9 Day 5 4uM Dorsomorphin Sigma-Aldrich #P5499 BC16 K02288 Day 2 Day 9 Day 5 0.5uM K02288 Cayman Chemical #16678 BC17 BMP4 Day 2 Day 9 Day 5 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC18 VEGF Day 2 Day 9 Day 5 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 Table 1. ..
Expressing:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
Microarray:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
CRISPR:Article Title: Combinatorial Smad2/3 Activities Downstream of Nodal Signaling Maintain Embryonic/Extra-Embryonic Cell Identities during Lineage Priming
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-mouse Nanog Abcam Cat#ab80892; RRID: AB_2150114 Lot: GR40243-12 Goat polyclonal anti-mouse Oct4 Santa Cruz Cat#sc-8628; RRID: AB_653551, Lot: F1815 Mouse monoclonal anti-mouse Klf4 Santa Cruz Cat#sc-393462, Lot: iO116 Rabbit polyclonal anti-human Ap2g Santa Cruz Cat#sc-8977; RRID: AB_2286995, Lot: G1112 Goat polyclonal anti-human Brachyury (N-19) Santa Cruz Cat#sc-17743; RRID: AB_634980, Lot: A1614 Rat monoclonal anti-mouse E-Cadherin Sigma-Aldrich Cat#U3254; RRID: AB_477600, Lot: 085K4798 Goat polyclonal anti-human Gata6 R&D Systems Cat#AF1700; RRID: AB_2108901, Lot: KWT-417101 Mouse monoclonal anti-human Cdx2 BioGenex Cat#MU392A-UC; RRID: AB_2650531, Lot: MU392A0713 Rabbit polyclonal anti-mouse Eomes Abcam Cat#ab23345; RRID: AB_778267, Lot:GR306193-1 Rabbit monoclonal anti-human Smad1/5/8 (embryo) Cell Signaling Technology Cat#13820; RRID: AB_2493181, Lot: D5810 Rabbit polyclonal anti-human Smad1/5/8 (Western blot) Merck-Millipore Cat#AB3848; RRID: AB_628261, Lot: JBC17774748 Mouse monoclonal anti-human Smad1 Santa Cruz Cat#sc-7965; RRID: AB_628261, Lot: A072 Rabbit polyclonal anti-mouse Id1 Santa Cruz Cat#sc-488; RRID: AB_631701, Lot: B082 Mouse monoclonal anti-mouse p-Smad2 BD Transduction Cat#610843; RRID:AB_398162, Lot: 3288899 Rabbit monoclonal anti-human Smad3 Abcam Cat#ab40854; RRID: AB_777979, Lot: GR16548-6 Rabbit polyclonal anti-human Tubulin Santa Cruz Cat#sc-9104; RRID: AB_2241191, Lot:I1009 Mouse polyclonal anti-rat Tuj1 Bio Legend Cat#801201; RRID: AB_2313773, Lot: B209227 Goat polyclonal anti-human Sox1 R&D Systems Cat#AF3369; RRID: AB_2239879, Lot:XUV0417031 Goat polyclonal anti-human Otx2 R&D Systems Cat#AF1979; RRID: AB_2157172, Lot: KNO0615111 Goat polyclonal anti-human Oct6 Santa Cruz Cat#sc-11661; RRID: AB_2268536 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-goat Alexa 488 Molecular Probes Cat#A11055; RRID: AB_142672 Donkey anti-mouse Alexa 488 Molecular Probes Cat#A21202; RRID: AB_141607 Donkey anti-rabbit Alexa 594 Thermo Fisher Scientific Cat#A21207; RRID: AB_141637 Donkey anti-goat Alexa 594 Molecular Probes Cat#A11058; RRID: AB_142540 Donkey anti-rabbit Alexa 488 Molecular Probes Cat#A21206; RRID: AB_141708 Donkey anti-rat 594 Molecular Probes Cat#A21209; RRID: AB_2535795 Donkey anti-rabbit HRP GE Healthcare Cat#NA934; RRID: AB_772206 Sheep anti-mouse HRP GE Healthcare Cat#NA931; RRID: AB_772212 (Continued on next page) e1 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and Virus Strains One Shot Stbl3 Chemically Competent E. coli Invitrogen Cat#C737303 Chemicals, Peptides, and Recombinant Proteins Recombinant human/murine/rat Activin A Peprotech Cat#120-14E, Lot: 1115478-1 Recombinant human bFGF Invitrogen Cat#13256-029, Lot: 1711319A LDN-193189 (small molecule inhibitor) Stemgent Cat#04-0074, Lot: 3061 Recombinant human BMP4 R&D Systems Cat314-BP, Lot: BEM11816121 Recombinant mouse SCF R&D Systems Cat#455-MC, Lot: CW1715062 Recombinant human Bmp8 R&D Systems Cat#1073-BP, Lot: EXU1116031 Recombinant mouse EGF R&D Systems Cat#2028-EG, Lot: MKG1016021 Human plasma fibronectin purified protein Millipore Cat#FC010 CHIR99021 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A PD0325091 Synthesized by the MRC Protein Phosphorylation Unit, Division of Signal Transduction Therapy at the University of Dundee, UK N/A Recombinant LIF (ESGRO) Millipore Cat#ESG1107, Lot: 2710245 Critical Commercial Assays Alkaline Phosphatase Detection Kit Millipore Cat#SCR004 Nextera DNA Library Preparation Kit Illumina Cat#FC-121-1030 Deposited Data RNA-seq on Smad2/3 DKO and control epiblastlike cells N/A GEO: GSE110163, Table S2, Series GSE110164 ATAC-seq on Smad2/3 DKO and control epiblast-like cells (including Tn5 control) N/A GEO: GSE110162, Table S3, Series GSE110164 Illumina MouseWG-6 v2.0 Expression BeadChip microarray on Smad2/3 DKO, Smad2 KO, Smad3 KO and WT mouse ESCs, d2 and d3 EBs N/A GEO: GSE110058, Table S1, Series GSE110164 Experimental Models: Cell Lines WT CCE 129/Sv//Ev embryonic stem cells (Robertson et al., 1986) N/A Smad2tm1Rob/tm1Rob 129/Sv//Ev embryonic stem cells (Tremblay et al., 2000) N/A Smad3tm1Xfw/tm1Xfw 129/Sv * C57BL/6 embryonic stem cells This study N/A Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A Smad2tm1Rob/tm1Rob;Smad3CRISPR/CRISPR 129/Sv//Ev embryonic stem cells This study N/A NIH 3T3 cells ATCC RRID: CVCL_0594 Experimental Models: Organisms/Strains Mouse: Smad3tm1Xfw/+: C57BL/6 Obtained from (Datto et al., 1999) RRID: MGI:2182651 Mouse: Smad2tm1Rob/+: C57BL/6 (Waldrip et al., 1998) MGI:1857691 Oligonucleotides Smad3 CRISPR_50 nick 1 forward CACCGCCCACG TGGGCCACCGGGTAGGG This study N/A Smad3 CRISPR_50 nick 1 reverse AAACTACCCGGT GGCCCACGTGGGC This study N/A (Continued on next page) Cell Reports 24, 1977–1985.e1–e7, August 21, 2018 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Smad3 CRISPR_50 nick 2 forward CACCGCGCTG GCGGCGCTGGGCGGGG This study N/A Smad3 CRISPR_50 nick 2 reverse AAACCGCCCA GCGCCGCCAAGCGC This study N/A Smad3 CRISPR_30 nick 1 forward CACCGTGTCCC GCCCCACTCGAAGCGC This study N/A Smad3 CRISPR_30 nick 1 reverse AAACCCGCTT CGAGTGGGGCGGGACAC This study N/A Smad3 CRISPR_30 nick 2 forward CACCGTCAGTA CATTCTGTCAGATCTGG This study N/A Smad3 CRISPR_30 nick 2 reverse AAACCCAGAT CTGACAGAATGTACTGAC This study N/A CRISPR_U6 sequencing primer forward GACTATCAT ATGCTTACCGT This study N/A Primers for qRT-PCR and OneStep RT-PCR analysis as well as mouse genotyping and Southern blot probe, see Table S4 This study N/A Recombinant DNA pSpCas9n(BB)-2A-GFP (PX461) (Ran et al., 2013) Addgene Plamid #18140 Software and Algorithms CRISPR design tool (Hsu et al., 2013) http://crispr.mit.edu Bowtie2 aligner (Langmead and Salzberg, 2012) http://bowtie-bio.sourceforge.net/ bowtie2/index.shtml STAR aligner (Dobin et al., 2013) https://github.com/alexdobin/STAR Samtools (Li et al., 2009) http://samtools.sourceforge.net/ Danpos2 (Chen et al., 2013) https://sites.google.com/site/ danposdoc/ MACS2 (Zhang et al., 2008) https://github.com/taoliu/MACS bedtools (Quinlan and Hall, 2010) http://bedtools.readthedocs.io/ en/latest/# UCSC Genome Browser https://genome.ucsc.edu/ DiffBind R package (Ross-Innes et al., 2012) https://bioconductor.org/packages/ release/bioc/html/DiffBind.html DESeq2 R package (Love et al., 2014) http://bioconductor.org/packages/ release/bioc/html/DESeq2.html HOMER (Heinz et al., 2010) http://homer.ucsd.edu/homer/ index.html JavaTreeView (Saldanha, 2004) http://jtreeview.sourceforge.net/ Analysis of Motif Enrichment Feature in the MEME suite (McLeay and Bailey, 2010) http://meme-suite.org/doc/ ame.html?man_type=web GREAT (McLean et al., 2010) http://bejerano.stanford.edu/great/ public/html/ Arrayanalysis (Eijssen et al., 2015) http://www.arrayanalysis.org/ BioVenn (Hulsen et al., 2008) http://www.biovenn.nl/ Fiji (Schindelin et al., 2012) https://imagej.net/Fiji Other Mus musculus rRNA genomic sequence GenBank BK000964.3 mm10 genome UCSC Genome Browser http://hgdownload.cse.ucsc.edu/ goldenPath/mm10/bigZips/ Sequencing data from Oct4, Otx2, p300, H3K4me1 and H3K27ac ChIP-seq in EpiLCs and RNA-seq in mouse ESCs and EpiLCs (Buecker et al., 2014) GSE56138 (Continued on next page) e3 Cell Reports 24, 1977–1985.e1–e7, August 21, 2018
other:Article Title: ERK5 promotes autocrine expression to sustain mitogenic balance for cell fate specification in human pluripotent stem cells
Article Snippet: Mouse anti-PAX6 DSHB Cat#AB528427 Rabbit anti-Brachyury (TBXT) R&D systems Cat#AF2085 Goat anti-NANOG R&D systems Cat#AF1997 Rabbit anti-P-Smad2 (S465/467) Cell signaling Cat#3108s Rabbit anti-T-Smad2 Cell signaling Cat#5339s Mouse anti-GAPDH Santa Cat#sc-25778 Rabbit anti-H3K27AC Abcam Cat#ab4729 Rabbit anti-H3K27ME3 Abcam Cat#ab195477 Rabbit anti-ERK5 Cell signaling Cat#3372 Rabbit anti-P-ERK5 (T218/T220) Cell signaling Cat#3371 Peroxidase AffiniPure Goat Anti-Mouse IgG (H+L) Jackson Immuno Research Cat#115-035-146 Peroxidase AffiniPure Goat Anti-Rabbit IgG (H+L) Jackson Immuno Research Cat#111-035-144 AffiniPure Donkey Anti-Goat IgG (H+L) Jackson Immuno Research Cat#705-005-147 Alexa Fluor 488 AffiniPure Goat Anti-Mouse IgG, Fcγ Fragment Specific Jackson Immuno Research Cat#115-545-071 Alexa Fluor 488 AffiniPure Goat Anti-Rabbit IgG, Fc Fragment Specific Jackson Immuno Research Cat#111-545-046
Article Title: Generation of Functional Liver Sinusoidal Endothelial Cells from Human Pluripotent Stem-Cell-Derived Venous Angioblasts.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Critical Commercial Assays VisuLize Factor VIII Antigen Kit (Lot:AG8-0050) Affinity Biologicals Cat# FVIII-AG Formaldehyde-treated serum albumin, FITC labeled D’Liver Cat# FSA-F Acetylated LDL-AF488 Invitrogen Cat# L23380 E.coli BioParticles-AF594 Invitrogen Cat# E23370 Human CD34 MicroBead Isolation kit Miltenyi Biotec Cat# 130-046-702 Human CD31 MicroBead Isolation kit Miltenyi Biotec Cat# 130-091-935 MS columns Miltenyi Biotec Cat# 130-042-201 LS columns Miltenyi Biotec Cat# 130-042-401 RNAqueous-micro kit with RNase-free DNase treatment Ambion Cat# AM1931 iSCRIPT Bio-Rad Cat# 1798841 QuantiFast SYBR Green PCR mix QIAGEN Cat# 204057 Histological Mouse and Rabbit Detection kit – MACH4 Inter Medico Cat# BC-M4U534L Histological Rabbit Detection kit – IMPRESS-AP Vector Cat# MP5401-15 Histological Developer kit, Warp Red Inter Medico Cat# BC-WR806H Histological Developer kit, DAB DAKO Cat# K3468 10x Genomics Single-Cell 30 V2 Reagents 10x Genomics Single Cell 30 v2 Deposited Data Primary Human Liver scRNaseq MacParland et al., 2018 GEO: GSE115469 hPSC-Venous Angioblast-derived in vivo matured LSECs - scRNaseq This study GEO: GSE131987 Experimental Models: Cell Lines Human ESC: HES2 Reubinoff et al., 2000 RRID: CVCL_D093 Human ESC: HES2:tdRFP Irion et al., 2007 N/A Human ESC: HES2:eGFP Irion et al., 2007 N/A Human ESC: H1-eGFP Davidson et al., 2012 N/A Experimental Models: Organisms/Strains NSG mice: NOD.Cg PrkdcscidIl2rgtm1Wjl/SzJ The Jackson Laboratory; OCI colony Cat# 005557 Oligonucleotides Primers for RT-qPCR This study Table S4 Software and Algorithms FlowJo Tree Star; https://www.flowjo.com Version 10 GraphPad Prism GraphPad Software; https://www. graphpad.com/scientific-software/prism Version 8 ImageJ (FIJI) FIJI (Schindelin et al., 2012); https://imagej. nih.gov/ij/ Version 2.0.0-rc-69/1.52p Aperio Image Scope Leica Biosystems; https://www. leicabiosystems.com/digital-pathology/ manage/aperio-imagescope/ Version 12.4.3 R CRAN https://cran.r-project.org/ Version 3.5 Cell Ranger https://support.10xgenomics.com/single- cell-gene-expression/software/pipelines/ latest/what-is-cell-ranger 10x Genomics, version 2.1.0 Scran https://git.bioconductor.org/ packages/scran Version 1.12.1 (Continued on next page) Cell Stem Cell 27, 1–16.e1–e9, August 6, 2020 e3
Article Title: Functional human gastrointestinal organoids can be engineered from three primary germ layers derived separately from pluripotent stem cells.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Biological samples Human Stomach and Duodenum Samples Wells Lab CCHMC GI-1B-9952 A B Human Antral and Fundic Samples Helmrath Lab CCHMC 14-241, 14-242, 14-243, 14-244 Human Stomach and Duodenum Samples CCHMC Pathology Core N/A Chemicals, peptides, and recombinant proteins 1x DMEM Invitrogen Cat# 11965-084 50x B27 supplement Thermo Fisher Scientific Cat# 17504044 50x B27 supplement w/o Vitamin A Thermo Fisher Scientific Cat# 12587-010 A8301 Torcis Cat# A83-01 Activin A Cell Guidance Systems Cat# GFH6 Accutase Thermo Fisher Scientific Cat# A11105-01 Advanced DMEM:F12 Thermo Fisher Scientfic Cat# 12634-010 Atropine sulfate salt monohydrate Sigma-Aldrich Cat# A0257 Bethanechol Sigma-Aldrich Cat# 1071009 C59 Cellagen Technology Cat# C7641-2s CHIR99021 ReproCell Cat# 04-0004-10 Collagen Type IV Thermo Fisher Scientific Cat# 17104019 Defined fetal bovine serum (dFBS) Hyclone Cat# SH30070.02 Dispase Thermo Fisher Scientific Cat# 17105-041 DMEM/F12 Thermo Fisher Scientific Cat# 11320033 DMEM/F-12, GlutaMAX Thermo Fisher Scientific Cat# 10565018 EGF Sigma-Aldrich Cat# 1257-0.1MG F12 Media Invitrogen Cat# 11765-054 Fetal Bovine Serum (FBS) HyClone Cat# SH30071.03 Fibronectin Corning Cat# 354008 Geltrex Thermo Fisher Scientific Cat# A1413201 HEPES Buffer Thermo Fisher Scientific Cat# 15630080 hESC-qualified Matrigel BD Biosciences Cat# 354277 Insulin from bovine pancreas Sigma-Aldrich Cat# I4011-50 L-glutamine (100x) Thermo Fisher Scientific Cat# 25030-081 L-NAME Sigma-Aldrich Cat# N5751 Matrigel Matrix Basement Membrane BD Biosciences Cat# 354234 mTeSR1 media Stem Cell Technologies Cat# 5850 N2 Supplement Thermo Fisher Scientific Cat# 17502-048 Non-essential Amino Acids (100x) Thermo Fisher Scientific Cat# 11140050 Normal donkey serum Jackson Immunoresearch Labs Cat# 017-000-121 Neurobasal Medium Thermo Fisher Scientific Cat# 21103049 PD0325901 Stem Cell Technologies Cat# 72184 Pen/Strep (100x) Thermo Fisher Scientific Cat# 15140-122 PIK90 EMD Millipore Cat# 528117 PMA Torcis Cat# 1201 recombinant human BMP4 R&D Systems Cat# 314-BP recombinant human EGF R&D Systems Cat# 236-EGF recombinant human FGF2 R&D Systems Cat# 233-FB recombinant human FGF4 R&D Systems Cat# 235-F4 recombinant human FGF10 R&D Systems Cat# 345-FG recombinant human Noggin R&D Systems Cat# 6057-NG recombinant human WNT3A R&D Systems Cat# 5036-WN (Continued on next page) Cell Stem Cell 29, 36–51.e1–e6, January 6, 2022 e2
Concentration Assay:Article Title: A pluripotent stem cell atlas of multilineage differentiation.
Article Snippet: .. For the remaining samples, cells were treated with a small molecule or recombinant protein signalling perturbation as detailed in Table 1, added BC Line Condition Library 1 Library 2 Library 3 Concentration Treatment Source BC01 Control Day 5 Day 2 Day 9 — — — BC02 Low XAV Day 5 Day 2 Day 9 1uM XAV939 STEMCELL Technologies #72674 BC03 XAV Day 5 — Day 9 5uM XAV939 STEMCELL Technologies #72674 BC04 CHIR Day 5 Day 2 Day 9 3uM CHIR99021 STEMCELL Technologies #72054 BC05 Low Dorso Day 5 Day 2 Day 9 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC06 Dorso Day 5 Day 2 Day 9 4uM Dorsomorphin Sigma-Aldrich #P5499 BC07 K02288 Day 5 Day 2 Day 9 0.5uM K02288 Cayman Chemical #16678 BC08 BMP4 Day 5 Day 2 Day 9 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC11 VEGF Day 5 Day 2 Day 9 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 BC10 Control Day 2 Day 9 Day 5 — — — BC09 Low XAV Day 2 Day 9 Day 5 1uM XAV939 STEMCELL Technologies #72674 BC12 XAV Day 2 Day 9 Day 5 5uM XAV939 STEMCELL Technologies #72674 BC13 CHIR Day 2 Day 9 Day 5 3uM CHIR99021 STEMCELL Technologies #72054 BC14 Low Dorso Day 2 Day 9 Day 5 0.4uM Dorsomorphin Sigma-Aldrich #P5499 BC15 Dorso Day 2 Day 9 Day 5 4uM Dorsomorphin Sigma-Aldrich #P5499 BC16 K02288 Day 2 Day 9 Day 5 0.5uM K02288 Cayman Chemical #16678 BC17 BMP4 Day 2 Day 9 Day 5 10 ng/mL Recombinant Human BMP4 R&D Systems #RDS314BP010 BC18 VEGF Day 2 Day 9 Day 5 100 ng/mL Recombinant Human VEGF R&D Systems #RDSPRD29350 Table 1. ..
SYBR Green Assay:Article Title: Adrenergic-Independent Signaling via CHRNA2 Regulates Beige Fat Activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-UCP1 Abcam Cat# ab10983; RRID: AB_2241462 Rabbit polyclonal anti-a-tubulin Cell Signaling Cat# 2144; RRID: AB_2210548 Total OXPHOS rodent antibody cocktail Abcam Cat# ab110413; RRID: AB_2629281 Rabbit monoclonal anti-phospho-CREB Cell Signaling Cat# 9198; RRID: AB_2561044 Rabbit monoclonal anti-CREB Cell Signaling Cat# 9197; RRID: AB_331277 Rabbit polyclonal anti-HSP90 Cell Signaling Cat# 4874; RRID: AB_2121214 Rabbit polyclonal anti-phospho-PKA substrate Cell Signaling Cat# 9621; RRID: AB_330304 Rabbit monoclonal anti-COX IV Cell Signaling Cat# 4850; RRID: AB_2085424 Rabbit monoclonal anti-VDAC Cell Signaling Cat# 4661; RRID: AB_10557420 Rabbit monoclonal anti-b-actin Cell Signaling Cat# 8457; RRID: AB_10950489 Chemicals 3-Isobutyl-1-methylxanthine Sigma Aldrich Cat# I7018 Acetylcholine chloride Sigma Aldrich Cat# A2661 Biotin Sigma Aldrich Cat# B4639 CL 316.243 hydrate Sigma Aldrich Cat# C5976 Dexamethasone Sigma Aldrich Cat# D4902 Dibutyryl-cAMP Sigma Aldrich Cat# D0260 D-pantothenic acid hemicalcium salt Sigma Aldrich Cat# P5155 Fura 2-AM Sigma Aldrich Cat# F0888 Insulin for cells Sigma Aldrich Cat# I5500 Insulin – Humulin R for ITT Eli Lily Cat# HI-210 Isoproterenol Sigma Aldrich Cat# I6504 Nicotine Sigma Aldrich Cat# N3876 Oligomycin A Sigma Aldrich Cat# 75351 Propranolol hydrochloride Sigma Aldrich Cat# PHR1308 Tri Reagent Sigma Aldrich Cat# 93289 Rosiglitazone Cayman chemical Cat# 71740 Recombinant human BMP4 R&D Systems Cat# 3141-BP-010 Collagenase D Roche Cat# 11088882001 Dispase II Roche Cat# 04942078001 SYBR Green Applied Biosystems Cat# 4368708 M-MLV Reverse Transcriptase Invitrogen Cat# 28025021 Critical Commercial Assays Cytochrome c Release Assay Kit Abcam Cat# ab65311 Citrate Synthase Activity Assay Kit Cayman chemical Cat# 701040 L-Lactate Assay Kit Cayman chemical Cat# 1200011002 Experimental Models: Cell Lines C2C12 cells ATCC Cat# CRL-1772 Mouse primary inguinal preadipocytes N/A N/A Human primary adipose stromal cells Dr. Jeffrey M. Gimble N/A Experimental Models: Organisms/Strains Mouse: Adiponectin-Cre The Jackson Laboratory Cat# 010803 Mouse: Myod1-CreERT2 The Jackson Laboratory Cat# 025667 (Continued on next page) Developmental Cell 54, 106–116.e1–e5, July 6, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ucp1 knockout The Jackson Laboratory Cat# 003124 Mouse: C57BL/6J The Jackson Laboratory Cat# 00664 Mouse: Ucp1-Cre The Jackson Laboratory Cat# 024679 Mouse: Chrna2 knockout The Jackson Laboratory Cat# 005797 Mouse: b-less Dr. Brad Lowell N/A Mouse: b1WT Dr. Jun Wu N/A Mouse: b3WT Dr. Jun Wu N/A Mouse: Chrna2fl/fl Dr. Jun Wu N/A Oligonucleotides qPCR primers, see Table S1 Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Fwd AGCACCAATCTGCGTTAATCTATG Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Rev ACTGTGAGATAGGGACAGAAAAGA Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Fwd CTGCCTTTTCATGCTGCACTCC Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Rev CCTCAGGGTCACCCAATCACAGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Fwd TCGCTACCAGAGTTTGCTGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Rev GGCACGTAGAAGGAGACGAC Integrated DNA Technologies N/A Genotyping: Adrb1 KO/Adrb2 KO 2/Adrb3 KO Fwd TCGCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb1 KO Rev GCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb2 WT/Adrb2 KO 1 Fwd GAGCGACTACAAACCGTCAC Integrated DNA Technologies N/A Genotyping: Adrb2 WT Rev CAGCAAGTCTCCTCGGTGTA Integrated DNA Technologies N/A Genotyping: Adrb3 WT Rev GCATGTTGGAGGCAAAGGAA Integrated DNA Technologies N/A Genotyping: Adrb3 KO Rev GCTTAGCCACAACGAACACTC Integrated DNA Technologies N/A Recombinant DNA MSCV-GFP Dr. Jun Wu N/A MSCV-CRE Dr. Jun Wu N/A Lentiviral vector for Gabpa GeneCopoeia Cat# EX-Mm02614-Lv120 Lentiviral shRNA clones 1 and 2 for Gabpa GeneCopoeia Cat# MSH027139-LVRU6GH Lentiviral shRNA clones for scrambled control GeneCopoeia Cat# CSHCTR001-LVRU6GH Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Excel Microsoft https://www.microsoft.com/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ MetaFluor software Molecular Devices https://www.moleculardevices.com/
Reverse Transcription:Article Title: Adrenergic-Independent Signaling via CHRNA2 Regulates Beige Fat Activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-UCP1 Abcam Cat# ab10983; RRID: AB_2241462 Rabbit polyclonal anti-a-tubulin Cell Signaling Cat# 2144; RRID: AB_2210548 Total OXPHOS rodent antibody cocktail Abcam Cat# ab110413; RRID: AB_2629281 Rabbit monoclonal anti-phospho-CREB Cell Signaling Cat# 9198; RRID: AB_2561044 Rabbit monoclonal anti-CREB Cell Signaling Cat# 9197; RRID: AB_331277 Rabbit polyclonal anti-HSP90 Cell Signaling Cat# 4874; RRID: AB_2121214 Rabbit polyclonal anti-phospho-PKA substrate Cell Signaling Cat# 9621; RRID: AB_330304 Rabbit monoclonal anti-COX IV Cell Signaling Cat# 4850; RRID: AB_2085424 Rabbit monoclonal anti-VDAC Cell Signaling Cat# 4661; RRID: AB_10557420 Rabbit monoclonal anti-b-actin Cell Signaling Cat# 8457; RRID: AB_10950489 Chemicals 3-Isobutyl-1-methylxanthine Sigma Aldrich Cat# I7018 Acetylcholine chloride Sigma Aldrich Cat# A2661 Biotin Sigma Aldrich Cat# B4639 CL 316.243 hydrate Sigma Aldrich Cat# C5976 Dexamethasone Sigma Aldrich Cat# D4902 Dibutyryl-cAMP Sigma Aldrich Cat# D0260 D-pantothenic acid hemicalcium salt Sigma Aldrich Cat# P5155 Fura 2-AM Sigma Aldrich Cat# F0888 Insulin for cells Sigma Aldrich Cat# I5500 Insulin – Humulin R for ITT Eli Lily Cat# HI-210 Isoproterenol Sigma Aldrich Cat# I6504 Nicotine Sigma Aldrich Cat# N3876 Oligomycin A Sigma Aldrich Cat# 75351 Propranolol hydrochloride Sigma Aldrich Cat# PHR1308 Tri Reagent Sigma Aldrich Cat# 93289 Rosiglitazone Cayman chemical Cat# 71740 Recombinant human BMP4 R&D Systems Cat# 3141-BP-010 Collagenase D Roche Cat# 11088882001 Dispase II Roche Cat# 04942078001 SYBR Green Applied Biosystems Cat# 4368708 M-MLV Reverse Transcriptase Invitrogen Cat# 28025021 Critical Commercial Assays Cytochrome c Release Assay Kit Abcam Cat# ab65311 Citrate Synthase Activity Assay Kit Cayman chemical Cat# 701040 L-Lactate Assay Kit Cayman chemical Cat# 1200011002 Experimental Models: Cell Lines C2C12 cells ATCC Cat# CRL-1772 Mouse primary inguinal preadipocytes N/A N/A Human primary adipose stromal cells Dr. Jeffrey M. Gimble N/A Experimental Models: Organisms/Strains Mouse: Adiponectin-Cre The Jackson Laboratory Cat# 010803 Mouse: Myod1-CreERT2 The Jackson Laboratory Cat# 025667 (Continued on next page) Developmental Cell 54, 106–116.e1–e5, July 6, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ucp1 knockout The Jackson Laboratory Cat# 003124 Mouse: C57BL/6J The Jackson Laboratory Cat# 00664 Mouse: Ucp1-Cre The Jackson Laboratory Cat# 024679 Mouse: Chrna2 knockout The Jackson Laboratory Cat# 005797 Mouse: b-less Dr. Brad Lowell N/A Mouse: b1WT Dr. Jun Wu N/A Mouse: b3WT Dr. Jun Wu N/A Mouse: Chrna2fl/fl Dr. Jun Wu N/A Oligonucleotides qPCR primers, see Table S1 Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Fwd AGCACCAATCTGCGTTAATCTATG Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Rev ACTGTGAGATAGGGACAGAAAAGA Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Fwd CTGCCTTTTCATGCTGCACTCC Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Rev CCTCAGGGTCACCCAATCACAGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Fwd TCGCTACCAGAGTTTGCTGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Rev GGCACGTAGAAGGAGACGAC Integrated DNA Technologies N/A Genotyping: Adrb1 KO/Adrb2 KO 2/Adrb3 KO Fwd TCGCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb1 KO Rev GCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb2 WT/Adrb2 KO 1 Fwd GAGCGACTACAAACCGTCAC Integrated DNA Technologies N/A Genotyping: Adrb2 WT Rev CAGCAAGTCTCCTCGGTGTA Integrated DNA Technologies N/A Genotyping: Adrb3 WT Rev GCATGTTGGAGGCAAAGGAA Integrated DNA Technologies N/A Genotyping: Adrb3 KO Rev GCTTAGCCACAACGAACACTC Integrated DNA Technologies N/A Recombinant DNA MSCV-GFP Dr. Jun Wu N/A MSCV-CRE Dr. Jun Wu N/A Lentiviral vector for Gabpa GeneCopoeia Cat# EX-Mm02614-Lv120 Lentiviral shRNA clones 1 and 2 for Gabpa GeneCopoeia Cat# MSH027139-LVRU6GH Lentiviral shRNA clones for scrambled control GeneCopoeia Cat# CSHCTR001-LVRU6GH Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Excel Microsoft https://www.microsoft.com/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ MetaFluor software Molecular Devices https://www.moleculardevices.com/
Release Assay:Article Title: Adrenergic-Independent Signaling via CHRNA2 Regulates Beige Fat Activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-UCP1 Abcam Cat# ab10983; RRID: AB_2241462 Rabbit polyclonal anti-a-tubulin Cell Signaling Cat# 2144; RRID: AB_2210548 Total OXPHOS rodent antibody cocktail Abcam Cat# ab110413; RRID: AB_2629281 Rabbit monoclonal anti-phospho-CREB Cell Signaling Cat# 9198; RRID: AB_2561044 Rabbit monoclonal anti-CREB Cell Signaling Cat# 9197; RRID: AB_331277 Rabbit polyclonal anti-HSP90 Cell Signaling Cat# 4874; RRID: AB_2121214 Rabbit polyclonal anti-phospho-PKA substrate Cell Signaling Cat# 9621; RRID: AB_330304 Rabbit monoclonal anti-COX IV Cell Signaling Cat# 4850; RRID: AB_2085424 Rabbit monoclonal anti-VDAC Cell Signaling Cat# 4661; RRID: AB_10557420 Rabbit monoclonal anti-b-actin Cell Signaling Cat# 8457; RRID: AB_10950489 Chemicals 3-Isobutyl-1-methylxanthine Sigma Aldrich Cat# I7018 Acetylcholine chloride Sigma Aldrich Cat# A2661 Biotin Sigma Aldrich Cat# B4639 CL 316.243 hydrate Sigma Aldrich Cat# C5976 Dexamethasone Sigma Aldrich Cat# D4902 Dibutyryl-cAMP Sigma Aldrich Cat# D0260 D-pantothenic acid hemicalcium salt Sigma Aldrich Cat# P5155 Fura 2-AM Sigma Aldrich Cat# F0888 Insulin for cells Sigma Aldrich Cat# I5500 Insulin – Humulin R for ITT Eli Lily Cat# HI-210 Isoproterenol Sigma Aldrich Cat# I6504 Nicotine Sigma Aldrich Cat# N3876 Oligomycin A Sigma Aldrich Cat# 75351 Propranolol hydrochloride Sigma Aldrich Cat# PHR1308 Tri Reagent Sigma Aldrich Cat# 93289 Rosiglitazone Cayman chemical Cat# 71740 Recombinant human BMP4 R&D Systems Cat# 3141-BP-010 Collagenase D Roche Cat# 11088882001 Dispase II Roche Cat# 04942078001 SYBR Green Applied Biosystems Cat# 4368708 M-MLV Reverse Transcriptase Invitrogen Cat# 28025021 Critical Commercial Assays Cytochrome c Release Assay Kit Abcam Cat# ab65311 Citrate Synthase Activity Assay Kit Cayman chemical Cat# 701040 L-Lactate Assay Kit Cayman chemical Cat# 1200011002 Experimental Models: Cell Lines C2C12 cells ATCC Cat# CRL-1772 Mouse primary inguinal preadipocytes N/A N/A Human primary adipose stromal cells Dr. Jeffrey M. Gimble N/A Experimental Models: Organisms/Strains Mouse: Adiponectin-Cre The Jackson Laboratory Cat# 010803 Mouse: Myod1-CreERT2 The Jackson Laboratory Cat# 025667 (Continued on next page) Developmental Cell 54, 106–116.e1–e5, July 6, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ucp1 knockout The Jackson Laboratory Cat# 003124 Mouse: C57BL/6J The Jackson Laboratory Cat# 00664 Mouse: Ucp1-Cre The Jackson Laboratory Cat# 024679 Mouse: Chrna2 knockout The Jackson Laboratory Cat# 005797 Mouse: b-less Dr. Brad Lowell N/A Mouse: b1WT Dr. Jun Wu N/A Mouse: b3WT Dr. Jun Wu N/A Mouse: Chrna2fl/fl Dr. Jun Wu N/A Oligonucleotides qPCR primers, see Table S1 Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Fwd AGCACCAATCTGCGTTAATCTATG Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Rev ACTGTGAGATAGGGACAGAAAAGA Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Fwd CTGCCTTTTCATGCTGCACTCC Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Rev CCTCAGGGTCACCCAATCACAGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Fwd TCGCTACCAGAGTTTGCTGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Rev GGCACGTAGAAGGAGACGAC Integrated DNA Technologies N/A Genotyping: Adrb1 KO/Adrb2 KO 2/Adrb3 KO Fwd TCGCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb1 KO Rev GCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb2 WT/Adrb2 KO 1 Fwd GAGCGACTACAAACCGTCAC Integrated DNA Technologies N/A Genotyping: Adrb2 WT Rev CAGCAAGTCTCCTCGGTGTA Integrated DNA Technologies N/A Genotyping: Adrb3 WT Rev GCATGTTGGAGGCAAAGGAA Integrated DNA Technologies N/A Genotyping: Adrb3 KO Rev GCTTAGCCACAACGAACACTC Integrated DNA Technologies N/A Recombinant DNA MSCV-GFP Dr. Jun Wu N/A MSCV-CRE Dr. Jun Wu N/A Lentiviral vector for Gabpa GeneCopoeia Cat# EX-Mm02614-Lv120 Lentiviral shRNA clones 1 and 2 for Gabpa GeneCopoeia Cat# MSH027139-LVRU6GH Lentiviral shRNA clones for scrambled control GeneCopoeia Cat# CSHCTR001-LVRU6GH Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Excel Microsoft https://www.microsoft.com/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ MetaFluor software Molecular Devices https://www.moleculardevices.com/
Activity Assay:Article Title: Adrenergic-Independent Signaling via CHRNA2 Regulates Beige Fat Activation.
Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-UCP1 Abcam Cat# ab10983; RRID: AB_2241462 Rabbit polyclonal anti-a-tubulin Cell Signaling Cat# 2144; RRID: AB_2210548 Total OXPHOS rodent antibody cocktail Abcam Cat# ab110413; RRID: AB_2629281 Rabbit monoclonal anti-phospho-CREB Cell Signaling Cat# 9198; RRID: AB_2561044 Rabbit monoclonal anti-CREB Cell Signaling Cat# 9197; RRID: AB_331277 Rabbit polyclonal anti-HSP90 Cell Signaling Cat# 4874; RRID: AB_2121214 Rabbit polyclonal anti-phospho-PKA substrate Cell Signaling Cat# 9621; RRID: AB_330304 Rabbit monoclonal anti-COX IV Cell Signaling Cat# 4850; RRID: AB_2085424 Rabbit monoclonal anti-VDAC Cell Signaling Cat# 4661; RRID: AB_10557420 Rabbit monoclonal anti-b-actin Cell Signaling Cat# 8457; RRID: AB_10950489 Chemicals 3-Isobutyl-1-methylxanthine Sigma Aldrich Cat# I7018 Acetylcholine chloride Sigma Aldrich Cat# A2661 Biotin Sigma Aldrich Cat# B4639 CL 316.243 hydrate Sigma Aldrich Cat# C5976 Dexamethasone Sigma Aldrich Cat# D4902 Dibutyryl-cAMP Sigma Aldrich Cat# D0260 D-pantothenic acid hemicalcium salt Sigma Aldrich Cat# P5155 Fura 2-AM Sigma Aldrich Cat# F0888 Insulin for cells Sigma Aldrich Cat# I5500 Insulin – Humulin R for ITT Eli Lily Cat# HI-210 Isoproterenol Sigma Aldrich Cat# I6504 Nicotine Sigma Aldrich Cat# N3876 Oligomycin A Sigma Aldrich Cat# 75351 Propranolol hydrochloride Sigma Aldrich Cat# PHR1308 Tri Reagent Sigma Aldrich Cat# 93289 Rosiglitazone Cayman chemical Cat# 71740 Recombinant human BMP4 R&D Systems Cat# 3141-BP-010 Collagenase D Roche Cat# 11088882001 Dispase II Roche Cat# 04942078001 SYBR Green Applied Biosystems Cat# 4368708 M-MLV Reverse Transcriptase Invitrogen Cat# 28025021 Critical Commercial Assays Cytochrome c Release Assay Kit Abcam Cat# ab65311 Citrate Synthase Activity Assay Kit Cayman chemical Cat# 701040 L-Lactate Assay Kit Cayman chemical Cat# 1200011002 Experimental Models: Cell Lines C2C12 cells ATCC Cat# CRL-1772 Mouse primary inguinal preadipocytes N/A N/A Human primary adipose stromal cells Dr. Jeffrey M. Gimble N/A Experimental Models: Organisms/Strains Mouse: Adiponectin-Cre The Jackson Laboratory Cat# 010803 Mouse: Myod1-CreERT2 The Jackson Laboratory Cat# 025667 (Continued on next page) Developmental Cell 54, 106–116.e1–e5, July 6, 2020 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Mouse: Ucp1 knockout The Jackson Laboratory Cat# 003124 Mouse: C57BL/6J The Jackson Laboratory Cat# 00664 Mouse: Ucp1-Cre The Jackson Laboratory Cat# 024679 Mouse: Chrna2 knockout The Jackson Laboratory Cat# 005797 Mouse: b-less Dr. Brad Lowell N/A Mouse: b1WT Dr. Jun Wu N/A Mouse: b3WT Dr. Jun Wu N/A Mouse: Chrna2fl/fl Dr. Jun Wu N/A Oligonucleotides qPCR primers, see Table S1 Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Fwd AGCACCAATCTGCGTTAATCTATG Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 5’ Rev ACTGTGAGATAGGGACAGAAAAGA Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Fwd CTGCCTTTTCATGCTGCACTCC Integrated DNA Technologies N/A Genotyping: Chrna2 floxed 3’ Rev CCTCAGGGTCACCCAATCACAGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Fwd TCGCTACCAGAGTTTGCTGA Integrated DNA Technologies N/A Genotyping: Adrb1 WT Rev GGCACGTAGAAGGAGACGAC Integrated DNA Technologies N/A Genotyping: Adrb1 KO/Adrb2 KO 2/Adrb3 KO Fwd TCGCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb1 KO Rev GCCTTCTTGACGAGTTCT Integrated DNA Technologies N/A Genotyping: Adrb2 WT/Adrb2 KO 1 Fwd GAGCGACTACAAACCGTCAC Integrated DNA Technologies N/A Genotyping: Adrb2 WT Rev CAGCAAGTCTCCTCGGTGTA Integrated DNA Technologies N/A Genotyping: Adrb3 WT Rev GCATGTTGGAGGCAAAGGAA Integrated DNA Technologies N/A Genotyping: Adrb3 KO Rev GCTTAGCCACAACGAACACTC Integrated DNA Technologies N/A Recombinant DNA MSCV-GFP Dr. Jun Wu N/A MSCV-CRE Dr. Jun Wu N/A Lentiviral vector for Gabpa GeneCopoeia Cat# EX-Mm02614-Lv120 Lentiviral shRNA clones 1 and 2 for Gabpa GeneCopoeia Cat# MSH027139-LVRU6GH Lentiviral shRNA clones for scrambled control GeneCopoeia Cat# CSHCTR001-LVRU6GH Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Excel Microsoft https://www.microsoft.com/ GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ MetaFluor software Molecular Devices https://www.moleculardevices.com/
cell culture:Article Title: Gene Correction Reverses Ciliopathy and Photoreceptor Loss in iPSC-Derived Retinal Organoids from Retinitis Pigmentosa Patients
Article Snippet: Antibodies Actin, α-Smooth Muscle antibody Sigma Cat# A5228 AFP R&D Systems Cat# MAB1368-SP SSEA4 Abcam Cat#AB16287 GFAP Life Technologies Cat#13-0300 Oct4 Abcam Cat#AB80893 Sox2 Santa Cruz Biotechnology Cat# sc-17319 Rhodopsin Sigma Cat# O4886 Brn3b Santa Cruz Biotechnology Cat# sc-6026 Recoverin Millipore Cat# AB5585 GT335 AdipoGen Cat# AG-20B-0020 Arl13b ProteinTech Cat# 17711-1-ap PKCα Sigma Cat# P4334 L/M-opsin Millipore Cat# AB5405 S-opsin VGLUT 1 Synaptophysin .. HCN1 Millipore Millipore Abcam Invitrogen Abcam Cat# AB5407 Cat#AB5905 Cat#AB32127 Cat#339100 Cat#AB176304 Chemicals, Peptides, and Recombinant Proteins GlutaMAX Supplement Life Technologies Cat# 35050-061 Non-essential Amino Acid Solution (100×) Sigma Cat# M7145 bFGF Recombinant Human Protein Gibco Cat# 13256029 PDGF-AB Recombinant Human Protein Gibco Cat# PHG0134 EGF Recombinant Human Protein Gibco Cat# PHG0311 Fugene Promega Cat# E2311 KnockOutTM Serum Replacement Gibco Cat# A3181502 β-mercaptoethanol Gibco Cat# 21985-023 TeSRTM-E8TM STEMCELL Technologies Cat# 05940 Matrigel, Growth Factor Reduced (GFR) Basement Membrane Matrix, Phenol Red-Free, *LDEV-Free Corning Cat# 356231 Y-27632 Selleck Cat# S1049 Monothioglycerol Sigma Cat# 96-27-5 Recombinant human BMP4 R&D Systems Cat# 314-BP N-2 Supplement (100X) Life Technologies Cat# 17502-048 V-bottomed conical wells plate CKI-7 dihydrochloride SB-431542 hydrate B-27® Supplement (50X) SumilonPrimeSurface Sumitomo Bakelite Sigma Sigma Gibco Cat# MS-9096V Cat# C0742-5MG Cat# S4317-5MG Cat# 0080085-SA GMEM Gibcao Cat# 11710-035 Critical Commercial Assays REGM Bullet Kit P3 Primary Cell 4D-NucleofectorTM Kit Lonza Lonza Cat# CC-3190 Cat# V4XP-3024 Episomal iPSC Kit System Biosciences Cat# SC900A-1 RNeasy Mini Kit Qiagen Cat# 74104 Oligonucleotides pX330-sgRNA-F CACCGCATGTAAACAACGTGTCACAA pX330-sgRNA-R AAACTTGTGACACGTTGTTTACATGC Primer F for correction verification CACAGACTAGAGAGTGGCAC Primer R for correction verification CCTCTACCCTTGTCTTTCTC pX330 Addgene Plasmid #42230 Software and Algorithms GraphPad Prism GraphPad Software Inc http://www.graphpad.com/scientific-software/pri sm/ Leica software Leica http://www.leica-microsystems.com/home/ ..
Saline:Article Title: Ligand-based directed differentiation to produce granulosa-like cells expressing steroidogenic enzyme genes.
Article Snippet: .. Key resources table Reagent or Resource Source Identifier Antibodies FOXL2 Abcam Cat# ab246511; RRID:AB_2895602 Donkey anti Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 568, Invitrogen Fisher Scientific Cat# A10042; RRID:AB_2534017 Hoechst Sigma-Aldrich Cat# B226125MG Chemicals, peptides, and recombinant proteins Advanced RPMI 1640 Medium Thermo Fisher Scientific Cat# 12633020 ROCK Inhibitor Y27632 ATCC Cat# ACS-3030 CHIR99021 EMD Millipore Cat# 361559- 5MG Gallocyanine Abcam Cat# ab145230 Recombinant human BMP4 R&D Systems Cat# 314-BP-050/ CF Recombinant human FST R&D Systems Cat# 669-FO025/CF Retinoic acid Sigma-Aldrich Cat# R262550MG Recombinant human SHH STEMCELL Technologies Cat# 78065 PD0325901 Sigma-Aldrich Cat# PZ01625MG Recombinant human EGF Sigma-Aldrich Cat# E96440.5MG Recombinant human FGF2 R&D Systems Cat# 233-FB-025/ CF Dulbecco’s Phosphate Buffered Saline Millipore Sigma Cat# D8537 Bovine Serum Albumin Ambion Cat# AM2616 Commercial assays Quick RNA MiniPrep Kit Zymo Research Cat# R1055 Oligonucleotides RT2 qPCR Primer Assay for Human NR5A1 Qiagen Cat# PPH05887B RT2 qPCR Primer Assay for Human CYP19A1 Qiagen Cat# PPH00132E RT2 qPCR Primer Assay for Human HSD17B1 Qiagen Cat# PPH21736B For custom primers for qPCR, See Table S1 Cell lines IISH2i-BM9 iPSC line WiCell IISH2i-BM9 STiPS-A3 iPSC line HSCI iPS core facility STiPS-A3 AN1.1 iPSC line GESC@ MGI at Washington University School of Medicine AN1.1 ..
Real-time Polymerase Chain Reaction:Article Title: Ligand-based directed differentiation to produce granulosa-like cells expressing steroidogenic enzyme genes.
Article Snippet: .. Key resources table Reagent or Resource Source Identifier Antibodies FOXL2 Abcam Cat# ab246511; RRID:AB_2895602 Donkey anti Rabbit IgG (H + L) Secondary Antibody, Alexa Fluor 568, Invitrogen Fisher Scientific Cat# A10042; RRID:AB_2534017 Hoechst Sigma-Aldrich Cat# B226125MG Chemicals, peptides, and recombinant proteins Advanced RPMI 1640 Medium Thermo Fisher Scientific Cat# 12633020 ROCK Inhibitor Y27632 ATCC Cat# ACS-3030 CHIR99021 EMD Millipore Cat# 361559- 5MG Gallocyanine Abcam Cat# ab145230 Recombinant human BMP4 R&D Systems Cat# 314-BP-050/ CF Recombinant human FST R&D Systems Cat# 669-FO025/CF Retinoic acid Sigma-Aldrich Cat# R262550MG Recombinant human SHH STEMCELL Technologies Cat# 78065 PD0325901 Sigma-Aldrich Cat# PZ01625MG Recombinant human EGF Sigma-Aldrich Cat# E96440.5MG Recombinant human FGF2 R&D Systems Cat# 233-FB-025/ CF Dulbecco’s Phosphate Buffered Saline Millipore Sigma Cat# D8537 Bovine Serum Albumin Ambion Cat# AM2616 Commercial assays Quick RNA MiniPrep Kit Zymo Research Cat# R1055 Oligonucleotides RT2 qPCR Primer Assay for Human NR5A1 Qiagen Cat# PPH05887B RT2 qPCR Primer Assay for Human CYP19A1 Qiagen Cat# PPH00132E RT2 qPCR Primer Assay for Human HSD17B1 Qiagen Cat# PPH21736B For custom primers for qPCR, See Table S1 Cell lines IISH2i-BM9 iPSC line WiCell IISH2i-BM9 STiPS-A3 iPSC line HSCI iPS core facility STiPS-A3 AN1.1 iPSC line GESC@ MGI at Washington University School of Medicine AN1.1 ..
|
R&D Systems is a verified supplier 
R&D Systems manufactures this product 
